The nucleotide sequence of phenylalanine tRNA from Mycoplasma sp. (Kid).

نویسندگان

  • M E Kimball
  • K S Szeto
  • D Soll
چکیده

The nucleotide sequence of Mycoplasma sp. (Kid) phenylalanine tRNA was determined to be pG-G-U-C-G-U-G-U-A-G-C-U-C-A-G-U-C-G-G-D-A-G-A-G-C-A-G-C- A-G-A-C-U-G-A-A-m(1)G-C-Psi-C-U-G-C-G-U-m(7)G-U-C-G-G-C-G-G-U-Psi-C-A-A-U-U-C-C-G-U-C-C-A-C-G-A-C-C-A-C-C-A(OH). It is characterized by the absence of ribothymidine and the presence of only few modified nucleotides.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Cloning and nucleotide sequence analysis of transfer RNA genes from Mycoplasma mycoides.

As part of an investigation of the tRNA genes of Mycoplasma mycoides, two HindIII fragments of mycoplasma DNA comprising 0.4 and 2.5 kilobases (kb), respectively, were cloned in pBR322 and their nucleotide sequences determined. Only one tRNA gene was found in the 0.4 kb fragment, the gene for tRNAArg with the anticodon TCT, while the 2.5 kb fragment contained nine different tRNA genes arranged ...

متن کامل

The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle i...

متن کامل

The vlhA gene sequencing of Iranian Mycoplasma synoviae isolates

Mycoplasma synoviae expressed variable lipoprotein haemagglutinin (VlhA) is believed to play a major role in pathogenesis of the disease by mediating adherence and immune evasion. The aim of this study was sequencing Iranian M. synoviae isolates for the detection of nucleotide variation in the M. synoviae vlhA gene. Using oligonucleotide primers complementary to the single-copy conserved 5´ end...

متن کامل

Molecular characterization of Mycoplasma synoviae isolates from commercial chickens in Iran

Detection of Mycoplasma synoviae (MS) by culture and polymerase chain reaction (PCR) has been reported from commercial chicken farms in different provinces of Iran. In some reports the phylogenetic analysis of MS isolates based on 16S rRNA and variable lipoprotein hemagglutinin (vlhA) genes have been carried out. The PCR product containing partial 16S rRNA genes of Iranain isolates was sequence...

متن کامل

Intraspecies Gene Variation within Putative Epitopes of Immunodominant Protein P48 of Mycoplasma agalactiae

P48 protein of Mycoplasma agalactiae is used to diagnose infection and was identified as potential vaccine candidate. According to the genetic nature of mycoplasma and variable sensitivity in P48-based serological diagnosis tests, intra species variation of P48 nucleotide sequence investigated in 13 field isolates of difference province of Iran along with three vaccine strains. Samples were col...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Nucleic acids research

دوره 1 12  شماره 

صفحات  -

تاریخ انتشار 1974